Fam114a1 gene
WebFAM114A2 (Family With Sequence Similarity 114 Member A2) is a Protein Coding gene. Diseases associated with FAM114A2 include Postural Orthostatic Tachycardia Syndrome and Phencyclidine Abuse. Among its related pathways are Oncogenic MAPK signaling and HIV Life Cycle. ... An important paralog of this gene is FAM114A1. [GeneCards] WebFAM114A1 has 2,879 functional associations with biological entities spanning 8 categories (molecular profile, organism, chemical, functional term, phrase or reference, disease, …
Fam114a1 gene
Did you know?
WebFAM114A1. General description of the gene and the encoded protein (s) using information from HGNC and Ensembl, as well as predictions made by the Human Protein Atlas project. Official gene symbol, which is typically a short form of the gene name, according to HGNC. Full gene name according to HGNC. WebUse Bio-Rad's PrimePCR assays, controls, templates for your target gene. Every primer pair is optimized, experimentally validated, and performance guaranteed. FAM114A1 - …
WebJun 7, 2024 · This study found that a potentially novel MI- and CAD-associated gene, FAM114A1, plays an important role in pathological cardiac remodeling and fibrosis. … WebFeb 21, 2024 · FAM114A1 is a host gene for miR-574 and shares the common promoter with embedded intronic miR-574 (31, 32). Both the host gene FAM114A1 and miR-574 expression is correlated . Thus, it is expected that FAM114A1 mRNA is induced in human and mouse MI and even aged murine hearts together with miR-574 (28-32).
WebFAM114A1. gene product. Noxp20. The protein encoded by this gene belongs to the FAM114 family and may play a role in neuronal cell development. Alternative splicing … WebSep 1, 2024 · Spermatogenesis is a highly complex and dynamic mechanism controlled by an elaborative system that includes precise gene expression in a developmental stage - dependent manner [1]. ... Fam114a2, also known as C5orf3 and its paralog Fam114a1, belong to nervous overexpress protein family and have been implicated in neuronal cell …
WebSep 1, 2024 · Fam114a2, also known as C5orf3 and its paralog Fam114a1, belong to nervous overexpress protein family and have been implicated in neuronal cell …
WebMar 24, 2024 · Offical Gene Symbol FAM114A1; Species Human (Homo sapiens) Offical Full Name family with sequence similarity 114 member A1; ... designs are created with VectorBuilder’s standard backbones containing a U6 promoter driving a gRNA targeting your gene of interest. A marker (e.g. EGFP) is place in the vector where appropriate. Vector … rochat giorgioWebMutation details: This allele from project Fam114a1-7878J-M7854 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences ACCAAGCAACCACATCTCCC, AGATGTGGTTGCTTGGTGGT, TTTGACATAGCGTACATTGA and ATGGAGTTTAACGTTTGCTC, which resulted in a … rochat horaireWebExpression of FAM114A1 (Noxp20) in cancer tissue. The cancer tissue page shows antibody staining of the protein in 20 different cancers. ... FAM114A1: Gene description i. Family with sequence similarity 114 member A1: Predicted location i … rochat infantWebThe evolutionarily conserved gene, Fam114a2, is dispensable for fertility in mouse Reprod Biol . 2024 Sep ... of in mice spermatogenesis. Moreover, the removal of Fam114a2 in mouse did not affect the expression of its paralogue Fam114a1 in multiple tissues. Taken together our data determined that Fam114a2 is not essential for male fertility and ... rochat maximeWebOct 26, 2024 · Gene ID: 92689, updated on 29-Mar-2024 Gene type: protein coding Also known as: Noxp20. See all available tests in GTR for this gene; Go to complete Gene … rochat fils nyonWebCM000666 ( FASTA) Hromosom 4 je jedan od 23 para hromosoma u čovjeka. Ljudi obično imaju dvije kopije ovog hromosoma. Uključije više od 186 miliona parova baza (građevinski materijal DNK) i predstavlja između 6 i 6,5 procenata ukupne DNK u ćeliji . rochat l\u0027abbayeWebGene summary (Entrez) i Useful information about the gene from Entrez The protein encoded by this gene belongs to the FAM114 family and may play a role in neuronal cell … rochat hotel basel